Scott Cain
2014-04-25 15:01:58 UTC
Hi Swetha,
Please ask questions like this on the gbrowse mailing list.
Did the directory.index file get created? Is there anything in the apache error log that might point to a problem? My first guess is a directory permission problem: the web server is unable the write in that directory.
Scott
Sent from my iPad
Please ask questions like this on the gbrowse mailing list.
Did the directory.index file get created? Is there anything in the apache error log that might point to a problem? My first guess is a directory permission problem: the web server is unable the write in that directory.
Scott
Sent from my iPad
Hello Sir,
I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
-Swetha.
<quote author='Scott Cain'>
Hi Eman,
The most likely problem is that you tried to view the DNA and GC content
before you added the fasta file. When that happens, GBrowse will create
the directory.index file with nothing in it. GBrowse doesn't know that you
added a fasta file after that, so it continues to think there is nothing
there. The fix is to delete the directory.index file and try again.
Scott
------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot
net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research
------------------------------------------------------------------------------
WatchGuard Dimension instantly turns raw network data into actionable
security intelligence. It gives you real-time visual feedback on key
security issues and trends. Skip the complicated setup - simply import
a virtual appliance and go from zero to informed in seconds.
http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
</quote>
http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
_____________________________________
Sent from http://generic-model-organism-system-database.450254.n5.nabble.com
I am new bie to GBrowse. I followed the tutorial and installed GBrowse. Its not displaying the GC content and six frame translation when I added the fasta file in the database directory. I would be very thankful if you could help me with this.
-Swetha.
<quote author='Scott Cain'>
Hi Eman,
The most likely problem is that you tried to view the DNA and GC content
before you added the fasta file. When that happens, GBrowse will create
the directory.index file with nothing in it. GBrowse doesn't know that you
added a fasta file after that, so it continues to think there is nothing
there. The fix is to delete the directory.index file and try again.
Scott
I have followed all the steps (include the GC content and 6 frame
translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
x86_64).
But, there are no "*GC content and 6 frame translation*" data displayed
as the snapscreen image.
(1)
http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
(2)
*ll /var/lib/gbrowse2/databases/*
drwxrwxrwx 2 root root 4096 Jan 27 17:49 volvox
*ll /var/lib/gbrowse2/databases/volvox*
-rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
*wc directory.index *
0 3 12288 directory.index
(3)
We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
into /var/lib/gbrowse2/databases/volvox/
(4)
we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
*more /var/lib/gbrowse2/databases/volvox/volvox.fa*
tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
......
(5)
*volvox.conf* in /etc/gbrowse2
[GENERAL]
db_adaptor = Bio::DB::SeqFeature::Store
db_args = -adaptor memory
-dir '/var/lib/gbrowse2/databases/volvox'
......
[DNA]
glyph = dna
global feature = 1
height = 40
do_gc = 1
gc_window = auto
fgcolor = red
axis_color = blue
strand = both
key = DNA/GC Content
......
Thanks.
eman
------------------------------------------------------------------------------
WatchGuard Dimension instantly turns raw network data into actionable
security intelligence. It gives you real-time visual feedback on key
security issues and trends. Skip the complicated setup - simply import
a virtual appliance and go from zero to informed in seconds.
http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
--translation) in the *gbrowse 2.55* *tutorial.html* (on CentoOS 6.4
x86_64).
But, there are no "*GC content and 6 frame translation*" data displayed
as the snapscreen image.
(1)
http://202.200.111.222/cgi-bin/gb2/gbrowse/volvox/
(2)
*ll /var/lib/gbrowse2/databases/*
drwxrwxrwx 2 root root 4096 Jan 27 17:49 volvox
*ll /var/lib/gbrowse2/databases/volvox*
-rw-r--r-- 1 apache apache 12288 Jan 27 17:49 directory.index
*wc directory.index *
0 3 12288 directory.index
(3)
We have put several volvox*.gff3(including *volvox_remarks.gff3*) files
into /var/lib/gbrowse2/databases/volvox/
(4)
we have put *volvox.fa* into /var/lib/gbrowse2/databases/volvox/
*more /var/lib/gbrowse2/databases/volvox/volvox.fa*
ctgA
cattgttgcggagttgaacaacggcattaggaacacttccgtctctcacttttatacgattatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg
......
(5)
*volvox.conf* in /etc/gbrowse2
[GENERAL]
db_adaptor = Bio::DB::SeqFeature::Store
db_args = -adaptor memory
-dir '/var/lib/gbrowse2/databases/volvox'
......
[DNA]
glyph = dna
global feature = 1
height = 40
do_gc = 1
gc_window = auto
fgcolor = red
axis_color = blue
strand = both
key = DNA/GC Content
......
Thanks.
eman
------------------------------------------------------------------------------
WatchGuard Dimension instantly turns raw network data into actionable
security intelligence. It gives you real-time visual feedback on key
security issues and trends. Skip the complicated setup - simply import
a virtual appliance and go from zero to informed in seconds.
http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
------------------------------------------------------------------------
Scott Cain, Ph. D. scott at scottcain dot
net
GMOD Coordinator (http://gmod.org/) 216-392-3087
Ontario Institute for Cancer Research
------------------------------------------------------------------------------
WatchGuard Dimension instantly turns raw network data into actionable
security intelligence. It gives you real-time visual feedback on key
security issues and trends. Skip the complicated setup - simply import
a virtual appliance and go from zero to informed in seconds.
http://pubads.g.doubleclick.net/gampad/clk?id=123612991&iu=/4140/ostg.clktrk
_______________________________________________
Gmod-gbrowse mailing list
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
</quote>
http://generic-model-organism-system-database.450254.n5.nabble.com/there-are-no-GC-content-and-6-frame-translation-data-displayed-when-done-by-tutorial-tp5712123p5712126.html
_____________________________________
Sent from http://generic-model-organism-system-database.450254.n5.nabble.com